version
PlantPromoterDB promoter information of J023119O20

Summary of Gene (J023119O20)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0631000        NCBI 
Gene model J023119O20  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 26117680-26118879)

Genome position     
from initiation codon
AK068667            
J013159L03          
J090098N20          
TSS from cDNA
TSS information
J023119O20                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023119O20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+26118508-172

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCTCCCTTCTCCTC+2611853826118555-142-125
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCTGGGCCGTG+2611836026118371-320-309
 OsREG486ATCTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG629 TCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGCCGTCGGATC+2611839726118406-283-274
 OsREG546CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588  GTCGGATC PPDB MotifCCGAC  PLACE Motif 
REGACCGGGCCCC+2611842026118429-260-251
 OsREG441ACCGGGCC   PPDB Motif  PLACE Motif 
 OsREG543 CCGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC PPDB MotifACGGGC  PLACE Motif 
REGGTCCGTCC+2611845826118465-222-215
 OsREG623GTCCGTCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.