version
PlantPromoterDB promoter information of J023120G14

Summary of Gene (J023120G14)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0279400        NCBI 
Gene model J023120G14  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 9562497-9561298)

Genome position     
from initiation codon
015-015-D10         
AK101851            
AK106253            
J013059L08          
J023079P21          
J033069K09          
J090042F16          
J090043J06          
J100039P20          
J100061C05          
J100085N15          
TSS from cDNA
TSS information
J023120G14                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023120G14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-9561595-98
TSS clone peakGclone-9561587-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCATGGGCCCCACCTG-95616549561669-157-172
 OsREG525CCATGGGC         PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC        PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG612      GCCCCACC   PPDB Motif  PLACE Motif 
 OsREG514        CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCC-95616949561701-197-204
 OsREG538CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCCACGGCCCAAG-95617139561724-216-227
 OsREG521CCACGGCC     PPDB Motif  PLACE Motif 
 OsREG504 CACGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG445  ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG563   CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581    GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.