version
PlantPromoterDB promoter information of J023132I24

Summary of Gene (J023132I24)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0210300        NCBI 
Gene model J023132I24  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 5699843-5698644)

Genome position     
from initiation codon
006-111-H06         
006-114-A01         
012-007-H08         
012-065-A02         
012-075-H05         
012-095-H06         
015-007-F02         
015-017-F10         
015-078-F12         
016-085-G04         
AK061267            
AK069330            
J023014M06          
J023026C01          
J023031M17          
J023037O21          
J023044J09          
J023057C12          
J023066N19          
J023072P11          
J023080D11          
J023099I10          
J023100L06          
J023121G14          
J023134J18          
J023148P15          
J033022D24          
J033024J23          
J033029B21          
J033030H09          
J033040N09          
J033045J06          
J033050I11          
J033052F03          
J033055H13          
J033067J22          
J033068K15          
J033069O11          
J033070A13          
J033072A02          
J033072F17          
J033079P05          
J033081C02          
J033082F08          
J033086L02          
J033087O09          
J033088P05          
J033094D13          
J033098I11          
J033102I15          
J033102P13          
J033103N07          
J033109A11          
J033109O05          
J033111K07          
J033113I09          
J033113I10          
J033115B12          
J033121D20          
J033125H21          
J033128M09          
J033133C04          
J033135L03          
J033136O13          
J043003H06          
J043004E15          
J043010B17          
J043015O11          
J043026D03          
J043029P05          
J043030G18          
J043035L17          
J043037K04          
J043040G24          
J053024N13          
J065035H08          
J065116G23          
J065138J15          
J065161L12          
J075011O04          
J075109M05          
J075133K12          
J075145J22          
J075158M02          
J075167H23          
J075198I09          
J090053N02          
J100023O11          
J100042B17          
J100052M16          
J100059M23          
J100076G19          
TSS from cDNA
TSS information
J023132I24                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023132I24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-5698960-117
TSS clone peakAclone-5698957-114

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATATATAG-56989845698995-141-152
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACTCCGTCCG-56990865699098-243-255
 OsREG532CCCACTCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG561     TCCGTCCG PPDB Motif  PLACE Motif 
REGGGCCCGGT-56991155699122-272-279
 OsREG441GGCCCGGT PPDB Motif  PLACE Motif 
REGATCCGACGG-56991935699201-350-358
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGACGCGTGG-56992535699260-410-417
 OsREG443ACGCGTGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.