version
PlantPromoterDB promoter information of J023134M10

Summary of Gene (J023134M10)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0574300        NCBI 
Gene model J023134M10  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 21709652-21708453)

Genome position     
from initiation codon
AK072541            
TSS from cDNA
TSS information
J023134M10                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023134M10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-21708654-2

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCCCC-21708619217086263326
Y PatchCTTCCTCCTCCC-2170863621708647165
Y PatchCCCCTTCCTC-2170868521708694-33-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCG-2170871021708717-58-65
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCATCCCCCA-2170879821708806-146-154
 OsREG516CATCCCCC  PPDB Motif  PLACE Motif 
 OsREG482 ATCCCCCA PPDB Motif  PLACE Motif 
REGCCAAGCCCACGGCC-2170880921708822-157-170
 OsREG519CCAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG496 CAAGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG427  AAGCCCAC     PPDB MotifGCCCA  PLACE Motif 
 OsREG463   AGCCCACG    PPDB MotifGCCCA  PLACE Motif 
 OsREG547    GCCCACGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG521      CCACGGCC PPDB Motif  PLACE Motif 
REGATCGGACGGCC-2170887421708884-222-232
 OsREG484ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624   GGACGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.