version
PlantPromoterDB promoter information of J023135O07

Summary of Gene (J023135O07)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0328400        NCBI 
Gene model J023135O07  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 12789958-12788759)

Genome position     
from initiation codon
006-092-H09         
009-085-A02         
012-078-B03         
AK061988            
J013073B13          
J023135L09          
J033027B12          
J033084P17          
J065010M05          
J065021N11          
J065021N12          
J065031K11          
J065072P04          
J065098D05          
J065122N23          
J065129L13          
J065135N13          
J065215N10          
J075120N22          
J090011G23          
J090014F06          
J090040G23          
J090075I20          
J090075N01          
J090089B04          
J090090F08          
J090091M17          
J090094L03          
J090099L06          
J100018A18          
J100027H13          
J100069C05          
J100086L10          
TSS from cDNA
TSS information
J023135O07                       5'->3' (-)
Promoter sequence








 
AK058517            
J065080I04          
J090004L19          
J090032M20          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023135O07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-12789060-102

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCAGCTATATAAGAG-1278908812789101-130-143
Y PatchCCTCTCTC-1278907712789084-119-126
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATCCAACGGC-1278911812789127-160-169
 OsREG481ATCCAACG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG518  CCAACGGC PPDB MotifCCAACGG  PLACE Motif 
REGCCGTCCGATC-1278913012789139-172-181
 OsREG545CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC PPDB Motif  PLACE Motif 
REGGCGGCCCATCT-1278916212789172-204-214
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGAAGCCCATAA-1278917412789184-216-226
 OsREG582GAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGCGGCCCAATA-1278919312789203-235-245
 OsREG618GCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG596   GCCCAATA PPDB MotifGCCCA  PLACE Motif 
REGCGGACGGA-1278928412789291-326-333
 OsREG561CGGACGGA PPDB Motif  PLACE Motif 
REGGTTGGTGG-1278932212789329-364-371
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.