version
PlantPromoterDB promoter information of J023143J07

Summary of Gene (J023143J07)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0634900        NCBI 
Gene model J023143J07  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 26339640-26340839)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J023143J07                       5'->3' (+)
Promoter sequence

 
003-004-F03         
009-069-F08         
AK059694            
J013067H17          
J013154H24          
J023128E17          
J033120A21          
J053050F13          
J053077G20          
J053090B15          
J053098J24          
J065100G18          
J065127K04          
J065157N17          
J075137F15          
J075195F14          
J080014C14          
J080014E08          
J090029A19          
J100059N24          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023143J07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26341119-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCTCTCTCCTCTT+2634108326341103-157-137
Y PatchCCTCCCTCTC+2634112726341136-113-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGCGTC+2634088426340891-356-349
 OsREG583GTCGCGTC PPDB Motif  PLACE Motif 
REGAGCCGTTGGCCCGTGGG+2634093826340954-302-286
 OsREG469AGCCGTTG          PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG         PPDB MotifCCAACGG  PLACE Motif 
 OsREG531         CCCGTGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGTCATGGGCTGA+2634100126341011-239-229
 OsREG609TCATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCAGA+2634102126341032-219-208
 OsREG456AGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAAG+2634103526341045-205-195
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCCCACCAC+2634104726341054-193-186
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.