version
PlantPromoterDB promoter information of J023143J07

Summary of Gene (J023143J07)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0634900        NCBI 
Gene model J023143J07  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 26341290-26342489)

Genome position     
from initiation codon
006-032-G12         
006-033-E09         
006-038-C03         
006-046-C06         
006-117-F10         
006-118-E01         
013-056-G08         
AK059769            
AK068583            
AK072855            
AK106210            
J023039K10          
J023061P22          
J023138P05          
J023146B18          
J033022O09          
J033092H12          
J033111L02          
J033135O03          
J033148P09          
J043006H17          
J065005K19          
J065044C17          
J065116K09          
J065119O21          
J065138I21          
J065169E06          
J065200O05          
J075014L05          
J075109H16          
J075117D04          
J100056F17          
J100057E24          
J100085M03          
TSS from cDNA
TSS information
J023143J07                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023143J07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+26341119-121

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCTCTCTCCTCTT+2634108326341103-157-137
Y PatchCCTCCCTCTC+2634112726341136-113-104
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCGCGTC+2634088426340891-356-349
 OsREG583GTCGCGTC PPDB Motif  PLACE Motif 
REGAGCCGTTGGCCCGTGGG+2634093826340954-302-286
 OsREG469AGCCGTTG          PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG         PPDB MotifCCAACGG  PLACE Motif 
 OsREG531         CCCGTGGG PPDB MotifGCCCA, ACGGGC  PLACE Motif 
REGTCATGGGCTGA+2634100126341011-239-229
 OsREG609TCATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG491  ATGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG657   TGGGCTGA PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCAGA+2634102126341032-219-208
 OsREG456AGATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638    GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCAAG+2634103526341045-205-195
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGCCCACCAC+2634104726341054-193-186
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.