version
PlantPromoterDB promoter information of J023143P09

Summary of Gene (J023143P09)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0641700        NCBI 
Gene model J023143P09  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 27365134-27366333)

Genome position     
from initiation codon
009-030-F09         
014-030-D10         
AF009413            
AK119728            
AK122129            
J023057A19          
J033132M21          
J065039D07          
J065062M22          
J065071L10          
J065088N13          
J065115D21          
J065187D07          
J075011B03          
J075011K23          
J075029J17          
J075038J07          
J075065A18          
J075083P05          
J075101G24          
J075127E19          
J075161K23          
J075175D23          
J090044M07          
J090065G16          
J090065J11          
J090097M02          
J090099D02          
J100056A20          
J100063M21          
TSS from cDNA
TSS information
J023143P09                       5'->3' (+)
Promoter sequence











 
AK068478            
AK073802            
J013152N07          
J033066O20          
J033148C20          
J053069D20          
J065008J10          
J065101D22          
J065164H18          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023143P09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+27366060-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCCGTGGAGGTGGGCCGGT+2736592627365950-208-184
 OsREG422AAATGGGC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT               PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG521     GGCCGTGG             PPDB Motif  PLACE Motif 
 OsREG476             AGGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG628              GGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564               GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542                TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440                 GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGCGCGTCGC+2736601127366018-123-116
 OsREG559CGCGTCGC PPDB Motif  PLACE MotifCGACG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-27365399AK068478, AK068478, AK073802

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGCCCATGA-2736543927365447AK068478, AK073802
 OsREG467AGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609 GCCCATGA PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCCCAACT-2736545627365469AK068478, AK073802
 OsREG593GTTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639  TTGGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479      GCCCAACT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.