version
PlantPromoterDB promoter information of J023149G21

Summary of Gene (J023149G21)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0156400        NCBI 
Gene model J023149G21  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 2778691-2779890)

Genome position     
from initiation codon
012-065-D02         
AK072086            
AK099278            
J013063H09          
J023125D09          
J033064E07          
J033093C07          
J033107E06          
J075172A11          
J090009E07          
J090023F13          
J090071N18          
TSS from cDNA
TSS information
J023149G21                       5'->3' (+)
Promoter sequence
















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J023149G21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2779614-77
TSS clone peakGclone+2779623-68

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCCTCCTCCTCTCTCTCTCCTCCCC+27795702779600-121-91
Y PatchCCCTTCTC+27796332779640-58-51
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCTGGGCCGTG+27794132779423-278-268
 OsREG620GCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504   GGGCCGTG PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCTC+27794292779439-262-252
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGCCAGGCCCATTT+27794472779458-244-233
 OsREG524CCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513 CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474  AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431   GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGCGCGTCTC+27794632779470-228-221
 OsREG560CGCGTCTC PPDB Motif  PLACE Motif 
REGCCGTGGGCCCACA+27794722779484-219-207
 OsREG547CCGTGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627     GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCACACGTGGCCGTGGGCCCC+27795022779527-189-164
 OsREG435ACAGCCCA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC                PPDB MotifGCCCA  PLACE Motif 
 OsREG526    CCCACACG               PPDB MotifGCCCA  PLACE Motif 
 OsREG434       ACACGTGG            PPDB MotifACGT  PLACE Motif 
 OsREG507        CACGTGGC           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG521             GGCCGTGG      PPDB Motif  PLACE Motif 
 OsREG547               CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571                CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG640                 GTGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG647                  TGGGCCCC PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAG+27795292779537-162-154
 OsREG435ACAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG512 CAGCCCAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.