version
PlantPromoterDB promoter information of J033023L12

Summary of Gene (J033023L12)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0701400        NCBI 
Gene model J033023L12  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 30406887-30405688)

Genome position     
from initiation codon
013-010-G06         
AK121229            
J023091M16          
J065043I07          
J065049E09          
J065054I05          
J065072H13          
J065073L10          
J065079P09          
J065112I06          
J065167C03          
J065167I03          
J065176P13          
J065205M07          
J075018E13          
J075021E04          
J075038F13          
J075051E05          
J075067C10          
J075079A12          
J075084A13          
J075103E20          
J075116E09          
J075118F15          
J075121I15          
J075129B01          
J075138A22          
J075159B22          
J075165I11          
J075186E09          
J075190J09          
J075191I07          
J080301C05          
J080302L02          
J100035C19          
J100059P06          
TSS from cDNA
TSS information
J033023L12                       5'->3' (-)
Promoter sequence










 
                    
Os06g0701500        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033023L12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-30405955-68

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGGCCCAGA-3040599530406004-108-117
 OsREG577CTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGACATGGGCTTTTCATGGGCCAGA-3040601230406034-125-147
 OsREG437ACATGGGC                PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT               PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT              PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT             PPDB MotifGCCCA  PLACE Motif 
 OsREG419    GGGCTTTT            PPDB MotifGCCCA  PLACE Motif 
 OsREG609           TCATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG517            CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488             ATGGGCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG577              TGGGCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG638               GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGGCTGGGCCAA-3040605230406062-165-175
 OsREG603GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG620 GCTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG578  CTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660   TGGGCCAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.