version
PlantPromoterDB promoter information of J033024A12

Summary of Gene (J033024A12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0221300        NCBI 
Gene model J033024A12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 6645071-6643872)

Genome position     
from initiation codon
011-021-E12         
AK073330            
J013130J18          
J065063H09          
J065093G05          
J090007K12          
TSS from cDNA
TSS information
J033024A12                       5'->3' (-)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033024A12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6644139-68

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCCCTT-66441566644163-85-92
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGCCCAAG-66442446644253-173-182
 OsREG658TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGTCTCGGCCCAACA-66442556644267-184-196
 OsREG635TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626    GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594     GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCAATT-66443096644319-238-248
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.