version
PlantPromoterDB promoter information of J033024K10

Summary of Gene (J033024K10)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0817600        NCBI 
Gene model J033024K10  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 35963539-35962340)

Genome position     
from initiation codon
006-085-G03         
AJ748648            
AK069892            
AK104501            
AK104802            
J013027H10          
J013061M17          
J013106L07          
J013118N15          
J013131H01          
J013170C08          
J023039N11          
J023060C13          
J033052I08          
J043022E17          
J090010H15          
J090011J11          
J090013H10          
J090017F04          
J090038P15          
J090060B02          
J100079J16          
TSS from cDNA
TSS information
J033024K10                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033024K10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-35962624-85
TSS clone peakCclone-35962622-83

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCCTCCTCCTCCTTTCCTCCCTCTC-3596262035962647-81-108
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACAGGTGGGGCCCAGG-3596271235962728-173-189
 OsREG501GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436 ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514  CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG612    GGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631     GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641      TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647       GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG579        GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550         GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGTTGTGGGCCCCACA-3596273835962751-199-212
 OsREG597TTGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG627 TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640  GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647   TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641    GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631     GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611      GCCCCACA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.