version
PlantPromoterDB promoter information of J033024N05

Summary of Gene (J033024N05)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0822100        NCBI 
Gene model J033024N05  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35372461-35373660)

Genome position     
from initiation codon
AK101094            
TSS from cDNA
TSS information
J033024N05                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033024N05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+35372481-980

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGCGGGCCTTGGGCTGTGGGCTGC+3537219335372216-1268-1245
 OsREG632TGCGGGCC                 PPDB Motif  PLACE Motif 
 OsREG497   GGGCCTTG              PPDB MotifGCCCA  PLACE Motif 
 OsREG459       CTTGGGCT          PPDB MotifGCCCA  PLACE Motif 
 OsREG511        TTGGGCTG         PPDB MotifGCCCA  PLACE Motif 
 OsREG435         TGGGCTGT        PPDB MotifGCCCA  PLACE Motif 
 OsREG461              TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG591                TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGCAAGTGGGGCGGGTCG+3537235935372374-1102-1087
 OsREG498CAAGTGGG         PPDB MotifGCCCA  PLACE Motif 
 OsREG552        GCGGGTCG PPDB Motif  PLACE Motif 
REGGGGCCGGCCCATAT+3537242635372439-1035-1022
 OsREG615GGGCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542   CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490    CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630     GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480      GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.