version
PlantPromoterDB promoter information of J033025C03

Summary of Gene (J033025C03)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0358400        NCBI 
Gene model J033025C03  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 14658278-14659477)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J033025C03                       5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033025C03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+14655991-87

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCTCTCTCCTCTT+1465598114655995-97-83
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCGAGG+1465572514655732-353-346
 OsREG549GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGAGTTGGGCCGAA+1465583914655850-239-228
 OsREG479AGTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG626 GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGCCCAGCCCATTT+1465586314655874-215-204
 OsREG533CCCAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG523 CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491  CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432   AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422    GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCAAACCGGCCCACCAC+1465589514655917-183-161
 OsREG419AAAAGCCC                PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG426  AAGCCCAA              PPDB MotifGCCCA  PLACE Motif 
 OsREG457   AGCCCAAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC            PPDB MotifGCCCA  PLACE Motif 
 OsREG440          ACCGGCCC      PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542           CCGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG564            CGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628             GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599              GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527               CCCACCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.