version
PlantPromoterDB promoter information of J033027N17

Summary of Gene (J033027N17)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0685300        NCBI 
Gene model J033027N17  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 35401429-35400230)

Genome position     
from initiation codon
004-013-B09         
006-021-B12         
006-021-F10         
006-026-C01         
006-031-B06         
006-038-H03         
006-040-B07         
006-058-C03         
006-062-B02         
006-067-B11         
006-069-H12         
006-072-D01         
006-081-E05         
006-086-B07         
006-092-G07         
006-095-G09         
006-098-A06         
006-099-G01         
006-102-E01         
006-103-E10         
006-114-A05         
006-115-B09         
006-118-F06         
006-119-E10         
006-120-A01         
AF039532            
AK070446            
AK104363            
J013039E18          
J013056F20          
J013131C19          
J013153O17          
J023054G10          
J023067E19          
J065016D15          
J065110L17          
J065127H09          
J065128G08          
J065144I11          
J065157E01          
J075017K12          
J075025L07          
J075045F11          
J075052C08          
J075070M16          
J075142H09          
J080001L06          
J080014O08          
J080015D20          
J080016M09          
J080017L03          
J080018B13          
J080031O11          
J080032P12          
J080034G03          
J080034G17          
J080034K17          
J080036K13          
J080057I07          
J080058N24          
J080063M08          
J080067C21          
J080070D01          
J080075H16          
J080078F06          
J080082L03          
J080083D21          
J080083F23          
J080086F13          
J080086N16          
J080090C17          
J080097I15          
J080097N15          
J100051G03          
J100071H01          
J100080G18          
TSS from cDNA
TSS information
J033027N17                       5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033027N17

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-35402005-126

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAACCC-3540202835402035-149-156
Y PatchTCTCCTCCTCCTCC-3540196935401982-90-103
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCGAGG-3540221535402222-336-343
 OsREG549GGGCGAGG PPDB MotifGCCCA  PLACE Motif 
REGCACACACC-3540227335402280-394-401
 OsREG499CACACACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.