version
PlantPromoterDB promoter information of J033032F05

Summary of Gene (J033032F05)

Organism Oryza sativa  
Chromosome 12  
Locus Os12g0599900        NCBI 
Gene model J033032F05  
Description NONE  
#
#

Overview

Focused view (chromosome 12: 25461568-25462767)

Genome position     
from initiation codon
AK101252            
AK111139            
TSS from cDNA
TSS information
J033032F05                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033032F05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+25462460-108

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCCC+2546243825462445-130-123
Y PatchTTCCTCTT+2546246125462468-107-100
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGGGCCCT+2546230525462315-263-253
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG475   TGGGCCCT PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCCCAACT+2546232125462334-247-234
 OsREG525CCATGGGC       PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCC      PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479      GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATTT+2546234625462356-222-212
 OsREG655TAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG432  AGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTCTCGGCCCGGCC+2546236225462374-206-194
 OsREG635TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575 CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG568  TCGGCCCG    PPDB MotifACGGGC  PLACE Motif 
 OsREG544   CGGCCCGG   PPDB Motif  PLACE Motif 
 OsREG616    GGCCCGGC  PPDB Motif  PLACE Motif 
 OsREG614     GCCCGGCC PPDB Motif  PLACE Motif 
REGATGGCCCACCTGTCAG+2546238825462403-180-165
 OsREG487ATGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC       PPDB MotifGCCCA  PLACE Motif 
 OsREG476   GCCCACCT      PPDB MotifGCCCA  PLACE Motif 
 OsREG514    CCCACCTG     PPDB MotifGCCCA  PLACE Motif 
 OsREG436     CCACCTGT    PPDB Motif  PLACE Motif 
 OsREG501      CACCTGTC   PPDB Motif  PLACE Motif 
 OsREG551        CCTGTCAG PPDB Motif  PLACE MotifTGAC 
REGACGTGGGGCCCAC+2546240725462419-161-149
 OsREG450ACGTGGGG      PPDB MotifACGT  PLACE Motif 
 OsREG572 CGTGGGGC     PPDB Motif  PLACE Motif 
 OsREG631  GTGGGGCC    PPDB Motif  PLACE Motif 
 OsREG641   TGGGGCCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG647    GGGGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG640     GGGCCCAC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.