version
PlantPromoterDB promoter information of J033036D08

Summary of Gene (J033036D08)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0760600        NCBI 
Gene model J033036D08  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33760503-33759304)

Genome position     
from initiation codon
AK067557            
AK103586            
J013112H20          
J033051F18          
J033130O03          
J033133B14          
J100047J15          
TSS from cDNA
TSS information
J033036D08                       5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033036D08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-33759536-283

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGCCTATATAAAAA-3375956333759576-310-323
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGATCGG-3375958433759591-331-338
 OsREG541CGGATCGG PPDB Motif  PLACE Motif 
REGGCTTTCCC-3375959533759602-342-349
 OsREG621GCTTTCCC PPDB Motif  PLACE Motif 
REGGAGGCGTGGA-3375962633759635-373-382
 OsREG503GAGGCGTG   PPDB Motif  PLACE Motif 
 OsREG636  GGCGTGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCCCGCG-3375931533759322011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGCCCCCACGCCAC-3375934033759351011-038-B09, AB110193, AK103133, AK104829, D14673, J023110C16, J033028M22, J033038A21, J033044D24, J033095C16, J090003F07, J090009P10, J090023K01, J090033G02, J090037I22, J090038A17, J090048K09, J090069N01, J090078C19, J090089P15, J090093D07, J090095H01, J100057J03
 OsREG536CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG502    CACGCCAC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.