version
PlantPromoterDB promoter information of J033038B14

Summary of Gene (J033038B14)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0758800        NCBI 
Gene model J033038B14  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 32238276-32239475)

Genome position     
from initiation codon
AJ252135            
AJ312906            
AK060387            
AK121592            
J023109G09          
J043013C09          
J053096E21          
J065026B08          
J065052H18          
J065062B16          
J065066E03          
J065091J12          
J065108M15          
J065120G15          
J065139M10          
J065158M16          
J065164A06          
J075014I20          
J075117N07          
J075142M03          
J075175D04          
J075188M01          
J075199I20          
J090010J12          
J090025O16          
J090041H05          
J090078P07          
J100031K10          
J100055F23          
J100064G05          
J100080C24          
J100080O07          
J100090F01          
TSS from cDNA
TSS information
J033038B14                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033038B14

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+32239083-193
TSS clone peakAclone+32239090-186

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCCC+3223910532239112-171-164
Y PatchTCCTCCTCC+3223912632239134-150-142
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCGTTGGGTGGGCCCCACGT+3223883932238859-437-417
 OsREG518GCCGTTGG              PPDB MotifCCAACGG  PLACE Motif 
 OsREG600      GGGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG628       GGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640        GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647         TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641          GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631           GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG572            GCCCCACG  PPDB Motif  PLACE Motif 
 OsREG450             CCCCACGT PPDB MotifACGT  PLACE Motif 
REGGATCCGACGG+3223891932238928-357-348
 OsREG588GATCCGAC   PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546  TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCGGGCCGAGCCGAATGGGCCGGC+3223898132239003-295-273
 OsREG568CGGGCCGA                PPDB MotifACGGGC  PLACE Motif 
 OsREG575 GGGCCGAG               PPDB MotifGCCCA  PLACE Motif 
 OsREG540    CCGAGCCG            PPDB Motif  PLACE Motif 
 OsREG431            AATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490             ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542              TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG615               GGGCCGGC PPDB MotifGCCCA  PLACE Motif 
REGAAAAGCCCATCCCACGGCCCGCTCTCCGC+3223900632239034-270-242
 OsREG419AAAAGCCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG421 AAAGCCCA                     PPDB MotifGCCCA  PLACE Motif 
 OsREG429  AAGCCCAT                    PPDB MotifGCCCA  PLACE Motif 
 OsREG466   AGCCCATC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG608    GCCCATCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG521           CCACGGCC           PPDB Motif  PLACE Motif 
 OsREG504            CACGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG446             ACGGCCCG         PPDB MotifACGGGC  PLACE Motif 
 OsREG576                     CTCTCCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.