version
PlantPromoterDB promoter information of J033040C13

Summary of Gene (J033040C13)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0122000        NCBI 
Gene model J033040C13  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 1189074-1190273)

Genome position     
from initiation codon
AK101458            
J013035K10          
J013050E10          
TSS from cDNA
TSS information
J033040C13                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033040C13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+1190028-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGCGGGCCCGGCCCATAT+11897661189783-308-291
 OsREG632TGCGGGCC           PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG543   GGGCCCGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG616    GGCCCGGC       PPDB Motif  PLACE Motif 
 OsREG614     GCCCGGCC      PPDB Motif  PLACE Motif 
 OsREG538      CCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542       CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490        CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630         GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480          GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCATA+11898241189833-250-241
 OsREG435ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA PPDB MotifGCCCA  PLACE Motif 
REGCACTGACA+11898381189845-236-229
 OsREG510CACTGACA PPDB Motif  PLACE MotifTGAC 
REGAGAGTGGGCCCATCGTGTCAGTG+11898611189883-213-191
 OsREG455AGAGTGGG                PPDB Motif  PLACE Motif 
 OsREG478  AGTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG489     GGGCCCAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG590      GGCCCATC          PPDB MotifGCCCA  PLACE Motif 
 OsREG553       GCCCATCG         PPDB MotifGCCCA  PLACE Motif 
 OsREG510               TGTCAGTG PPDB Motif  PLACE MotifTGAC 
REGCGTGTGGGCT+11899481189957-126-117
 OsREG526CGTGTGGG   PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GTGTGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461  TGTGGGCT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.