version
PlantPromoterDB promoter information of J033044H02

Summary of Gene (J033044H02)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0169400        NCBI 
Gene model J033044H02  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 4145249-4144050)

Genome position     
from initiation codon
AK073439            
J013110E15          
TSS from cDNA
TSS information
J033044H02                       5'->3' (-)
Promoter sequence












 
AK120872            
J090073N18          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033044H02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4144250-1

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCT-41442724144279-23-30
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGCCCAAC-41444134144423-164-174
 OsREG644TCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 
REGAAATGGGCCGAA-41444294144440-180-191
 OsREG422AAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCGAAACAGGTGGGACCCACTCT-41444424144471-193-222
 OsREG610TAATGGGC                       PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC                      PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA                    PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG634     GGCCGAAA                  PPDB Motif  PLACE Motif 
 OsREG436            ACAGGTGG           PPDB Motif  PLACE Motif 
 OsREG514             CAGGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG651               GGTGGGAC        PPDB MotifGGGACCC  PLACE Motif 
 OsREG650                GTGGGACC       PPDB MotifGGGACCC  PLACE Motif 
 OsREG648                 TGGGACCC      PPDB MotifGGGACCC  PLACE Motif 
 OsREG637                  GGGACCCA     PPDB MotifGGGACCC  PLACE Motif 
 OsREG622                   GGACCCAC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG455                      CCCACTCT PPDB Motif  PLACE Motif 
REGGCTGGGCCGGATCGGGCCGA-41444914144510-242-261
 OsREG620GCTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG           PPDB MotifGCCCA  PLACE Motif 
 OsREG644   GGGCCGGA          PPDB MotifGCCCA  PLACE Motif 
 OsREG541       CGGATCGG      PPDB Motif  PLACE Motif 
 OsREG568            CGGGCCGA PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.