version
PlantPromoterDB promoter information of J033044K11

Summary of Gene (J033044K11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0738600        NCBI 
Gene model J033044K11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 32587855-32589054)

Genome position     
from initiation codon
AK073479            
AK120616            
J013045F15          
J013046M12          
J013149L22          
J013152B11          
J023007A09          
J023007N03          
J023012K17          
J023042A01          
J023059P06          
J023113A05          
J033082E04          
J090027I22          
J090033B13          
J090062H08          
J100086G23          
TSS from cDNA
TSS information
J033044K11                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033044K11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+32588645-210
TSS clone peakCclone+32588681-174

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCCTCTCTCCTCC+3258866232588677-193-178
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGGGGG+3258848832588495-367-360
 OsREG536CGTGGGGG PPDB Motif  PLACE Motif 
REGGAGGCCCAAAC+3258850532588515-350-340
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGTTGGCCCATGG+3258853032588540-325-315
 OsREG660TTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525   GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCCATGGGCT+3258855232588560-303-295
 OsREG525CCATGGGC  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467 CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGGCGGCCCAAG+3258856432588573-291-282
 OsREG618GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581  GGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGACACGTG+3258861632588623-239-232
 OsREG509GACACGTG PPDB MotifACGT  PLACE MotifACGTGKC 
REGACCGGCCC+3258862632588633-229-222
 OsREG440ACCGGCCC PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.