version
PlantPromoterDB promoter information of J033046C02

Summary of Gene (J033046C02)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0555000        NCBI 
Gene model J033046C02  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 21825416-21824217)

Genome position     
from initiation codon
015-020-G02         
AK065270            
AK121253            
J013002L01          
J023060A02          
J023101O11          
J023140A15          
J033042H19          
J033080N19          
J065026I02          
J065040C18          
J090004I16          
TSS from cDNA
TSS information
J033046C02                       5'->3' (-)
Promoter sequence











 
Os02g0555100        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033046C02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-21824548-132
TSS clone peakGclone-21824543-127

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTGGGCTCTGGGCCGTGGGCCGTC-2182459621824620-180-204
 OsREG461TGTGGGCT                  PPDB MotifGCCCA  PLACE Motif 
 OsREG629       TCTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG565        CTGGGCCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG445         TGGGCCGTGGGCCGT  PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504          GGGCCGTG        PPDB MotifGCCCA  PLACE Motif 
 OsREG521           GGCCGTGG       PPDB Motif  PLACE Motif 
 OsREG547             CCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571              CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564               GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG584                 GGGCCGTC PPDB MotifGCCCA  PLACE Motif 
REGCCGTGGGCCTC-2182462521824635-209-219
 OsREG547CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGAAAGCCCACCAC-2182464721824658-231-242
 OsREG421AAAGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG527    CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGTCGCGCGC-2182480621824813-390-397
 OsREG617TCGCGCGC PPDB Motif  PLACE Motif 
REGCCCCCGCG-2182481821824825-402-409
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.