version
PlantPromoterDB promoter information of J033046D05

Summary of Gene (J033046D05)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0190900        NCBI 
Gene model J033046D05  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 4923132-4921933)

Genome position     
from initiation codon
012-063-F11         
AK073533            
J013110O09          
J033041I12          
J033101K24          
J090009F10          
J090095B17          
TSS from cDNA
TSS information
J033046D05                       5'->3' (-)
Promoter sequence










 
AK071379            
AK103440            
J065156E15          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033046D05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4922238-106

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGGGGGT-49222914922298-159-166
 OsREG438TGGGGGGT PPDB Motif  PLACE Motif 
REGAATTGGGCCTA-49223064922316-174-184
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGTCTGGGCCGTTTGGGCCGAA-49223234922342-191-210
 OsREG629TCTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG            PPDB MotifGCCCA  PLACE Motif 
 OsREG445  TGGGCCGT           PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423   GGGCCGTT          PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG420    GGCCGTTT         PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG593        GTTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625         TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563          TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658           TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642            GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGCCACCAAC-49223534922360-221-228
 OsREG520CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGGCGTGGA-49224444922451-312-319
 OsREG636GGCGTGGA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+4922425AK071379, AK071379, AK103440

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCACCAC+49221554922162AK071379, AK103440
 OsREG527CCCACCAC PPDB MotifGCCCA  PLACE Motif 
REGCTCTCCGC+49221894922196AK071379, AK103440
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGCGGACGGC+49222014922208AK071379, AK103440
 OsREG562CGGACGGC PPDB Motif  PLACE Motif 
REGTGATGGGC+49222354922242AK071379, AK103440
 OsREG607TGATGGGC PPDB MotifGCCCA  PLACE Motif 
REGCTCCCCCA+49222564922263AK071379, AK103440
 OsREG574CTCCCCCA PPDB Motif  PLACE Motif 
REGTTGGCCCAGA+49222684922277AK071379, AK103440
 OsREG660TTGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG578 TGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629  GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGACCCCCCA+49222914922298AK071379, AK103440
 OsREG438ACCCCCCA PPDB Motif  PLACE Motif 
REGTAGGCCCAATT+49223064922316AK071379, AK103440
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433   GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTTCGGCCCAAACGGCCCAGA+49223234922342AK071379, AK103440
 OsREG642TTCGGCCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA           PPDB MotifGCCCA  PLACE Motif 
 OsREG625   GGCCCAAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG593    GCCCAAAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG420        AAACGGCC     PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423         AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445          ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565           CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG629            GGCCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG+49223534922360AK071379, AK103440
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.