PlantPromoterDB promoter information of J033048F09

Summary of Gene (J033048F09)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0661900        NCBI 
Gene model J033048F09  
Description NONE  


Focused view (chromosome 4: 34175547-34176746)

Genome position     
from initiation codon
TSS from cDNA
TSS information
J033048F09                       5'->3' (+)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


Promoter Summary of J033048F09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneAclone+34175994J100039F24, J053077D04, 006-090-F11, J090095N01
TSS clone peakAclone+34176042J100039F24, J053077D04, 006-090-F11, J090095N01
TSS cloneGclone+34176052J100039F24, J053077D04, 006-090-F11, J090095N01
TSS cloneAclone+34176066J100039F24, J053077D04, 006-090-F11, J090095N01

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGGTTGGTGGTCATGGGCCAAAAAGCCCAACT+3417584334175872006-090-F11, J053077D04, J090095N01, J100039F24
 OsREG520GTTGGTGG                       PPDB MotifCCAACGG  PLACE Motif 
 OsREG609        TCATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG517         CATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488          ATGGGCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG660           TGGGCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG419                  AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421                   AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426                    AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458                     AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479                      GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGACC+3417589034175897006-090-F11, J053077D04, J090095N01, J100039F24

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.