version
PlantPromoterDB promoter information of J033051D07

Summary of Gene (J033051D07)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0184800        NCBI 
Gene model J033051D07  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 4514709-4515908)

Genome position     
from initiation codon
AK059544            
AK099050            
AK102642            
AK106132            
J023037O08          
J023050M02          
J023087A10          
J033027D14          
J033028N17          
J033043P10          
J033073M07          
J033075H01          
J033084E04          
J033096D10          
J033100F04          
J033114B06          
J033117C10          
J033140B21          
J043034J07          
J065006F04          
J065130H16          
J075020G13          
J075108M17          
J100046F24          
TSS from cDNA
TSS information
J033051D07                       5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033051D07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+4515599-110
TSS clone peakAclone+4515602-107

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGTGGGC+45153934515401-316-308
 OsREG531CCCGTGGG  PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC PPDB MotifGCCCA  PLACE Motif 
REGCCGTCGGAT+45154374515445-272-264
 OsREG546CCGTCGGA  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483 CGTCGGAT PPDB MotifCCGAC  PLACE MotifCGACG 
REGCCGATCCGACGG+45154514515462-258-247
 OsREG541CCGATCCG     PPDB Motif  PLACE Motif 
 OsREG588  GATCCGAC   PPDB MotifCCGAC  PLACE Motif 
 OsREG483   ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546    TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCGCGTCTC+45155084515515-201-194
 OsREG560CGCGTCTC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+4515769J023037O08, J033073M07, J033096D10, J080018A06, J080037J11, J080048F15, J080057D16, J080069A10, J080086L09, J080088A17

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.