version
PlantPromoterDB promoter information of J033064A11

Summary of Gene (J033064A11)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0103200        NCBI 
Gene model J033064A11  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 214306-213107)

Genome position     
from initiation codon
003-106-F06         
015-058-G03         
AK060850            
AK066032            
J013046D12          
J013088L18          
J013093J06          
J013111I01          
J013120B15          
J013149K17          
J023010J08          
J023034J10          
J023055D05          
J033023L03          
J033025N21          
J033026A19          
J033026M14          
J033046J22          
J033052H11          
J033058P05          
J033067K11          
J033076H02          
J033094E04          
J033106A02          
J033108N14          
J033114I06          
J033118H18          
J033148C05          
J043010I24          
J043037C07          
J053025M02          
J053026N08          
J053027O14          
J065038N11          
J065219C03          
J090011F14          
J090027C03          
J090067M19          
J090069C17          
J090070P21          
J090075N11          
J090095C22          
J100027O14          
J100055E01          
TSS from cDNA
TSS information
J033064A11                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033064A11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-213394-88
TSS clone peakCclone-213357-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCTCC-213352213361-46-55
Y PatchTCTTCCTCTT-213378213387-72-81
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATTGGGCCGAA-213444213455-138-149
 OsREG433AATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG642    GGGCCGAA PPDB MotifGCCCA  PLACE Motif 
REGCAAGGCCCACA-213464213474-158-168
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472  AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627   GGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGTCGCGCGC-213557213564-251-258
 OsREG617TCGCGCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.