version
PlantPromoterDB promoter information of J033064L23

Summary of Gene (J033064L23)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0199600        NCBI 
Gene model J033064L23  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 4976402-4975203)

Genome position     
from initiation codon
AK101774            
AK120040            
J023047I06          
J033117I01          
J033123I18          
J053026H17          
J053078G05          
J065102A09          
J065113G11          
J065207F20          
J075027K21          
TSS from cDNA
TSS information
J033064L23                       5'->3' (-)
Promoter sequence

















 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033064L23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-4976098-696

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCTCTCTCTCTCTCTCTCTCTCT-49761064976132-704-730
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCCAC-49761684976175-766-773
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGTCGGCCCATTAACGGCCCACGT-49761864976207-784-805
 OsREG658TCGGCCCA               PPDB MotifGCCCA  PLACE Motif 
 OsREG490 CGGCCCAT              PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT             PPDB MotifGCCCA  PLACE Motif 
 OsREG610   GCCCATTA            PPDB MotifGCCCA  PLACE Motif 
 OsREG423          AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445           ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564            CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571             GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG449              GCCCACGT PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
REGTCAGCCCATCA-49762244976234-822-832
 OsREG657TCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG607   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGTCATGGGCCCATCACCGGCCCACA-49762414976264-839-862
 OsREG609TCATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 OsREG517 CATGGGCC                PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG590     GGCCCATC            PPDB MotifGCCCA  PLACE Motif 
 OsREG607      GCCCATCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG440             ACCGGCCC    PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542              CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564               CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG627                GGCCCACA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.