PlantPromoterDB promoter information of J033066B11
Summary of Gene (J033066B11)
|
Overview
|
Focused view (chromosome 1: 31294351-31293152)
|
Genome position
from initiation codon TSS from cDNA TSS information J033066B11 5'->3' (-) Promoter sequence 016-011-C09
AK103899 J013030B12 J013060B08 J023039L03 J023062D20 J023095D22 J023149L17 J033150J04 J043007P18 J043009E19 J043021M07 J043036M19 J043037L10 J043038O17 J090061D01 J090061M05 TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of J033066B11
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | G | clone | - | 31292009 | -308 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GGCCGTCCG | - | 31292071 | 31292079 | -370 | -378 | |||
| OsREG624 | GGCCGTCC | PPDB Motif | PLACE Motif | ||||||
| OsREG562 | GCCGTCCG | PPDB Motif | PLACE Motif | ||||||
| REG | AGCCGTTGGAT | - | 31292101 | 31292111 | -400 | -410 | |||
| OsREG469 | AGCCGTTG | PPDB Motif | CCAACGG | PLACE Motif | |||||
| OsREG518 | GCCGTTGG | PPDB Motif | CCAACGG | PLACE Motif | |||||
| OsREG548 | CCGTTGGA | PPDB Motif | CCAACGG | PLACE Motif | |||||
| OsREG481 | CGTTGGAT | PPDB Motif | CCAACGG | PLACE Motif | |||||
| REG | TTTTGGGCCTTAGGCCCATAT | - | 31292256 | 31292276 | -555 | -575 | |||
| OsREG592 | TTTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG625 | TTTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG471 | TTGGGCCT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG430 | TGGGCCTT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG656 | TAGGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG474 | AGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG630 | GGCCCATA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG480 | GCCCATAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | GGTTGGGCTTGAAGCCCAAC | - | 31292288 | 31292307 | -587 | -606 | |||
| OsREG595 | GGTTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG496 | TGGGCTTG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG582 | GAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG426 | TTGGGCTT AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG458 | GTTGGGCT AGCCCAAC | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||