version
PlantPromoterDB promoter information of J033066B11

Summary of Gene (J033066B11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0710800        NCBI 
Gene model J033066B11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 31294351-31293152)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J033066B11                       5'->3' (-)
Promoter sequence

 
016-011-C09         
AK103899            
J013030B12          
J013060B08          
J023039L03          
J023062D20          
J023095D22          
J023149L17          
J033150J04          
J043007P18          
J043009E19          
J043021M07          
J043036M19          
J043037L10          
J043038O17          
J090061D01          
J090061M05          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033066B11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-31292009-308

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCGTCCG-3129207131292079-370-378
 OsREG624GGCCGTCC  PPDB Motif  PLACE Motif 
 OsREG562 GCCGTCCG PPDB Motif  PLACE Motif 
REGAGCCGTTGGAT-3129210131292111-400-410
 OsREG469AGCCGTTG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG518 GCCGTTGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG548  CCGTTGGA  PPDB MotifCCAACGG  PLACE Motif 
 OsREG481   CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 
REGTTTTGGGCCTTAGGCCCATAT-3129225631292276-555-575
 OsREG592TTTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG656          TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474           AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630            GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG480             GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGGTTGGGCTTGAAGCCCAAC-3129228831292307-587-606
 OsREG595GGTTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG496   TGGGCTTG          PPDB MotifGCCCA  PLACE Motif 
 OsREG582          GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426  TTGGGCTT AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG458 GTTGGGCT   AGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.