version
PlantPromoterDB promoter information of J033069F02

Summary of Gene (J033069F02)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0220600        NCBI 
Gene model J033069F02  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 6750232-6751431)

Genome position     
from initiation codon
009-091-E01         
009-127-G02         
AK061944            
AK104946            
D89802              
J013042L22          
J013056A14          
J013120G13          
J013155K19          
J023002B10          
J023080J19          
J023081C08          
J023090H05          
J023091M07          
J023115F09          
J033025I23          
J033026G12          
J033035E15          
J033040N13          
J033046C17          
J033071B16          
J033071N22          
J033088J02          
J033092N24          
J033093I09          
J033099G13          
J033100M18          
J033126G06          
J043003G15          
J043010M11          
J043024O20          
J065092N03          
J080004D17          
J080010L09          
J080021I11          
J080022L01          
J080029B01          
J080032D11          
J080039B11          
J080040K17          
J080041B21          
J080052L24          
J080054M12          
J080057B15          
J080078G15          
J080078H06          
J080079M03          
J080088H16          
J080093C11          
J080095K09          
J080095O20          
J090009J19          
J090040D04          
J090052E14          
J090063B14          
J090071K04          
J090075E12          
J090087A06          
J090094P03          
J090098M14          
TSS from cDNA
TSS information
J033069F02                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033069F02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+6750988-244

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGGCCCGTT+67507976750807-435-425
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGATCCAACGG+67508116750819-421-413
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGGGGCCAGA+67508336750840-399-392
 OsREG638GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGCCGTCCGATC+67508866750896-346-336
 OsREG562GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC PPDB Motif  PLACE Motif 
REGATCGGACGGCCGAGAT+67509146750929-318-303
 OsREG484ATCGGACG         PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG        PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC       PPDB Motif  PLACE Motif 
 OsREG624   GGACGGCC      PPDB Motif  PLACE Motif 
 OsREG635       GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485        GCCGAGAT PPDB Motif  PLACE Motif 
REGACCCGCGC+67509316750938-301-294
 OsREG439ACCCGCGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.