version
PlantPromoterDB promoter information of J033071H21

Summary of Gene (J033071H21)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0325300        NCBI 
Gene model J033071H21  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 10109038-10110237)

Genome position     
from initiation codon
011-005-H08         
AK068435            
AK073998            
J065214H05          
TSS from cDNA
TSS information
J033071H21                       5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033071H21

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+10110005-33

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCCTCTT+1011002010110029-18-9
Y PatchTCTCTCCCCC+101100381011004709
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTCGGCCCAATT+1010977010109782-268-256
 OsREG634TTTCGGCC      PPDB Motif  PLACE Motif 
 OsREG642 TTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG563   CGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492    GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433     GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTCGGCCCAAACTTGGGCCGGCCCGTT+1010979210109817-246-221
 OsREG658TCGGCCCA                   PPDB MotifGCCCA  PLACE Motif 
 OsREG563 CGGCCCAA  TTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA                 PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC                PPDB MotifGCCCA  PLACE Motif 
 OsREG581          CTTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG542            TGGGCCGG       PPDB MotifGCCCA  PLACE Motif 
 OsREG615             GGGCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG424                  GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGCGCACGCG+1010983010109837-208-201
 OsREG555CGCACGCG PPDB Motif  PLACE Motif 
REGGCGGCCCAGG+1010986010109869-178-169
 OsREG618GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG550  GGCCCAGG PPDB MotifGCCCA  PLACE Motif 
REGGTCAGTGG+1010989910109906-139-132
 OsREG522GTCAGTGG PPDB Motif  PLACE MotifTGAC 
REGCTGGCCCAACGCGGAGAG+1010990910109926-129-112
 OsREG577CTGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG626  GGCCCAAC         PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG576          GCGGAGAG PPDB Motif  PLACE Motif 
REGCCGAGCCGTCCGAT+1010993010109943-108-95
 OsREG540CCGAGCCG       PPDB Motif  PLACE Motif 
 OsREG468   AGCCGTCC    PPDB Motif  PLACE Motif 
 OsREG562    GCCGTCCG   PPDB Motif  PLACE Motif 
 OsREG545     CCGTCCGA  PPDB Motif  PLACE Motif 
 OsREG484      CGTCCGAT PPDB Motif  PLACE Motif 
REGGGACGGCT+1010994810109955-90-83
 OsREG468GGACGGCT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.