version
PlantPromoterDB promoter information of J033072I24

Summary of Gene (J033072I24)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0139400        NCBI 
Gene model J033072I24  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 2111886-2113085)

Genome position     
from initiation codon
AB096864            
AK065558            
AK099140            
AK099183            
J013033B01          
J013050K15          
J013105P12          
J013157B14          
J023052E04          
J023086K05          
J023099C15          
J023126B14          
J033025C08          
J043020I04          
J090039I21          
J090049O22          
J090078P20          
J090084C18          
J100024F07          
J100054D22          
J100062O08          
TSS from cDNA
TSS information
J033072I24                       5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033072I24

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+2112213-673
TSS clone peakGclone+2112249-637

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCCT+21121962112205-690-681
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTGGGGCCCAGC+21120752112087-811-799
 OsREG611TGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG579    GGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620     GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGACGTCACC+21121002112107-786-779
 OsREG447ACGTCACC PPDB MotifACGT  PLACE MotifTGAC 
REGACGTGTCC+21121242112131-762-755
 OsREG451ACGTGTCC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGCGTGGGCCCCACTCC+21121402112156-746-730
 OsREG530CGCGTGGG          PPDB MotifGCCCA  PLACE Motif 
 OsREG602 GCGTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC    PPDB Motif  PLACE Motif 
 OsREG532         CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.