version
PlantPromoterDB promoter information of J033075K16

Summary of Gene (J033075K16)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0113600        NCBI 
Gene model J033075K16  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 777197-778396)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J033075K16                       5'->3' (+)
Promoter sequence

 
AK107286            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033075K16

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+778996-101
TSS clone peakGclone+778999-98

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTCCGATC+778721778728-376-369
 OsREG589GTCCGATC PPDB Motif  PLACE Motif 
REGACGTGGGCCAG+778826778836-271-261
 OsREG449ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571 CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654  GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCGAAA+778850778861-247-236
 OsREG627TGTGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG564 GTGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658  TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG642   GGGCCGAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG634    GGCCGAAA PPDB Motif  PLACE Motif 
REGTTATGGGCCCAACT+778863778876-234-221
 OsREG605TTATGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG489  ATGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG639    GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG626     GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479      GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCGGA+778881778892-216-205
 OsREG493ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563  TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGATTTGGGCCTCCCATGGGCCAT+778920778941-177-156
 OsREG493ATTTGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG625 TTTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT             PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC            PPDB MotifGCCCA  PLACE Motif 
 OsREG525           CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517            CATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488             ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG487              TGGGCCAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.