version
PlantPromoterDB promoter information of J033076A08

Summary of Gene (J033076A08)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0602600        NCBI 
Gene model J033076A08  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 25026052-25027251)

Genome position     
from initiation codon
006-033-D11         
006-046-H02         
006-056-H08         
006-115-A01         
009-116-D05         
AK072671            
AK104660            
J023134P20          
J023141O13          
J033066I15          
J033135A08          
J033150J23          
J065114P19          
J065176B01          
J065207H21          
J080301L21          
J080308A08          
J080318K23          
J080319F17          
J080319I10          
J090028C08          
J090051I24          
J090053L21          
J090069C20          
J100017G08          
J100042B06          
J100045G24          
J100050J19          
J100052D23          
J100053M03          
J100056D08          
J100066B19          
J100071N23          
J100074H01          
J100074H19          
J100077C06          
TSS from cDNA
TSS information
J033076A08                       5'->3' (+)
Promoter sequence











 
                    
Os11g0602700        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033076A08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+25026991-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATAAAAG+2502695525026962-97-90
Y PatchCTCTCCTCTT+2502696525026974-87-78
Y PatchCTCCTCCTCCCCT+2502697725026989-75-63
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGAGGGAC+2502673225026739-320-313
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGTGAGGGAC+2502678825026795-264-257
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGATATGGGCCTT+2502682125026831-231-221
 OsREG480ATATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGAAGGCCCATTT+2502683925026849-213-203
 OsREG430AAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCCTA+2502686225026871-190-181
 OsREG627TGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656  TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGTAATGGGCCGAGA+2502688825026900-164-152
 OsREG610TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TGGGCCGA   PPDB MotifGCCCA  PLACE Motif 
 OsREG575    GGGCCGAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG635     GGCCGAGA PPDB Motif  PLACE Motif 
REGATCTCGGCCCATTT+2502690225026915-150-137
 OsREG485ATCTCGGC       PPDB Motif  PLACE Motif 
 OsREG635 TCTCGGCC      PPDB Motif  PLACE Motif 
 OsREG575  CTCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG658   TCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490    CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG431     GGCCCATT  PPDB MotifGCCCA  PLACE Motif 
 OsREG422      GCCCATTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.