version
PlantPromoterDB promoter information of J033086A13

Summary of Gene (J033086A13)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0810000        NCBI 
Gene model J033086A13  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 36169260-36168061)

Genome position     
from initiation codon
AK071916            
AK099056            
AK102143            
AK104320            
AK120752            
J023006E09          
J033133K07          
J065066L16          
J065161C01          
J100027D18          
J100063J12          
TSS from cDNA
TSS information
J033086A13                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033086A13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-36168323-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGGGCCCAAAC-3616844936168459-189-199
 OsREG475AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG639 GGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGGTTTGGGCTGGGCTGC-3616848736168502-227-242
 OsREG593GTTTGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG457 TTTGGGCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG511  TTGGGCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG464      GCTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG512       CTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG591        TGGGCTGC PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGTCAGGCCCAATT-3616851536168536-255-276
 OsREG480ATATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT            PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584    GGGCCGTC           PPDB MotifGCCCA  PLACE Motif 
 OsREG646          TCAGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG513           CAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG471            AGGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG492             GGCCCAAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG433              GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.