version
PlantPromoterDB promoter information of J033089F12

Summary of Gene (J033089F12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0869800        NCBI 
Gene model J033089F12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 39451956-39453155)

Genome position     
from initiation codon
006-022-E10         
006-029-B06         
006-029-F03         
006-048-B10         
006-059-D08         
006-064-B02         
006-067-H02         
006-078-H08         
006-084-A06         
006-100-E10         
006-120-D09         
009-194-G07         
AK058284            
AK071827            
AK104275            
J013049J07          
J023118A05          
J065002B16          
J065022H06          
J065045M23          
J065084D13          
J065169K05          
J065215C11          
J075063H07          
J075190D21          
J090090F24          
J090094I11          
TSS from cDNA
TSS information
J033089F12                       5'->3' (+)
Promoter sequence




 
                    
Os01g0869750        
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033089F12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+39452871-85

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCTCGGCC+3945259939452606-357-350
 OsREG635TCTCGGCC PPDB Motif  PLACE Motif 
REGCGCGTCGCG+3945266039452668-296-288
 OsREG559CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556 GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGGAGACGTGGC+3945268839452697-268-259
 OsREG506GAGACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG585  GACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCACGCCACGCGGCCCATG+3945277139452788-185-168
 OsREG502CACGCCAC           PPDB Motif  PLACE Motif 
 OsREG618        GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG490         CGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG517          GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGCCCACCCG+3945279839452805-158-151
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.