version
PlantPromoterDB promoter information of J033092H11

Summary of Gene (J033092H11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0172400        NCBI 
Gene model J033092H11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 3728439-3727240)

Genome position     
from initiation codon
AK065102            
AK100365            
AK119523            
D73411              
J013001N03          
J013052B12          
J013071F15          
J013108F19          
J023025E17          
J023083O10          
J023084M17          
J023100D16          
J023107O10          
J023119F08          
J033035B07          
J033052C18          
J033096D02          
J033117A16          
J043010E08          
J043013C12          
J065001M15          
J065021O11          
J065089O20          
J065117N05          
J065129L11          
J065170F18          
J090066E11          
J090076N24          
J090093G21          
J100041H17          
J100050D07          
J100063A06          
TSS from cDNA
TSS information
J033092H11                       5'->3' (-)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033092H11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-3727731-292
TSS clone peakAclone-3727551-112

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTC-37275123727520-73-81
Y PatchTCCTCCTCTCC-37276903727700-251-261
Y PatchCTCTCCCC-37277233727730-284-291
Y PatchCTCCCCTT-37277403727747-301-308
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAGCCCAG-37276403727648-201-209
 OsREG655TAAGCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG428 AAGCCCAG PPDB MotifGCCCA  PLACE Motif 
REGATCTCGGC-37277153727722-276-283
 OsREG485ATCTCGGC PPDB Motif  PLACE Motif 
REGACGCGTGGTGGG-37278683727879-429-440
 OsREG443ACGCGTGG     PPDB Motif  PLACE Motif 
 OsREG527    GTGGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCGCGACGCGAC-37279723727982-533-543
 OsREG556CGCGACGC    PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG   PPDB Motif  PLACE MotifCGACG 
 OsREG583   GACGCGAC PPDB Motif  PLACE Motif 
REGCCCCCGCG-37280193728026-580-587
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.