version
PlantPromoterDB promoter information of J033092H19

Summary of Gene (J033092H19)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0394200        NCBI 
Gene model J033092H19  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 19398454-19399653)

Genome position     
from initiation codon
AK068154            
AK104832            
AK121002            
J013061L12          
J013130A17          
J023007C02          
J023024J19          
J023028L02          
J023059E23          
J023079J15          
J023102N08          
J023104E17          
J023128D24          
J023145K24          
J023146B04          
J033031M21          
J033040F04          
J033045E12          
J033048K17          
J043021N15          
J065071D20          
J065087F02          
J065105J08          
J065108G22          
J065201J22          
J090026H05          
J090033H19          
J090063G16          
J100030K12          
J100046K03          
J100068C18          
TSS from cDNA
TSS information
J033092H19                       5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033092H19

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+19399285-169
TSS clone peakAclone+19399364-90

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCCCCCTTCCTCC+1939924219399260-212-194
Y PatchCCTCTCTCT+1939928619399294-168-160
Y PatchCCCTTCTCC+1939936819399376-86-78
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACTGACAGGTGGGCCCACCA+1939919119399211-263-243
 OsREG510CACTGACA              PPDB Motif  PLACE MotifTGAC 
 OsREG453 ACTGACAG             PPDB Motif  PLACE MotifTGAC 
 OsREG551  CTGACAGG            PPDB Motif  PLACE MotifTGAC 
 OsREG501    GACAGGTG          PPDB Motif  PLACE Motif 
 OsREG436     ACAGGTGG         PPDB Motif  PLACE Motif 
 OsREG514      CAGGTGGG        PPDB MotifGCCCA  PLACE Motif 
 OsREG476       AGGTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640         GTGGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG628        GGTGGGCCCACC  PPDB MotifGCCCA  PLACE Motif 
 OsREG599             GCCCACCA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.