version
PlantPromoterDB promoter information of J033092N18

Summary of Gene (J033092N18)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0116000        NCBI 
Gene model J033092N18  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 854892-853693)

Genome position     
from initiation codon
AK058320            
AK121775            
J023003L12          
J023025C18          
J023074E20          
J023122K17          
J023128H09          
J065009J09          
J090073L21          
TSS from cDNA
TSS information
J033092N18                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033092N18

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-854136-244
TSS clone peakAclone-853985-93

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxAGCTATAAATA-854014854024-122-132
Y PatchTCTCCTCTT-853944853952-52-60
Y PatchTCCTCCTC-853954853961-62-69
Y PatchCCCCTCCTCC-853993854002-101-110
Y PatchCCCCTCCC-854178854185-286-293
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCACGCGT-854172854180-280-288
 OsREG530CCCACGCG  PPDB MotifGCCCA  PLACE Motif 
 OsREG443 CCACGCGT PPDB Motif  PLACE Motif 
REGCCACTGACATGCGGGCCCCAC-854212854232-320-340
 OsREG522CCACTGAC              PPDB Motif  PLACE MotifTGAC 
 OsREG510 CACTGACA             PPDB Motif  PLACE MotifTGAC 
 OsREG632         TGCGGGCC     PPDB Motif  PLACE Motif 
 OsREG619          GCGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG567           CGGGCCCC   PPDB MotifACGGGC  PLACE Motif 
 OsREG641            GGGCCCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG631             GGCCCCAC PPDB Motif  PLACE Motif 
REGGCCCCACG-854275854282-383-390
 OsREG572GCCCCACG PPDB Motif  PLACE Motif 
REGCATCCACC-854284854291-392-399
 OsREG515CATCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.