version
PlantPromoterDB promoter information of J033094E23

Summary of Gene (J033094E23)

Organism Oryza sativa  
Chromosome 6  
Locus Os06g0583500        NCBI 
Gene model J033094E23  
Description NONE  
#
#

Overview

Focused view (chromosome 6: 23687275-23686076)

Genome position     
from initiation codon
AK103785            
J013034M04          
J013074L17          
J013169I02          
J023024B09          
J023132L02          
J033026C23          
J033101D23          
J033125B15          
J033144I11          
J033145E13          
J033145I11          
J065022M23          
J065043I24          
J065053G06          
J065088K03          
J065121L09          
J065143M08          
J065146H02          
J065206M03          
J075004L13          
J075005L17          
J075007G18          
J075027E20          
J075029A19          
J075041C15          
J075045M11          
J075046M05          
J075066P21          
J075069E07          
J075107P21          
J075123F03          
J075124E07          
J075140J22          
J075160N03          
TSS from cDNA
TSS information
J033094E23                       5'->3' (-)
Promoter sequence







 
                    
Os06g0583600        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033094E23

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-23686931-656

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGGCCCATGAGGCCCATA-2368697123686989-696-714
 OsREG660TTGGCCCA            PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT           PPDB MotifGCCCA  PLACE Motif 
 OsREG517  GGCCCATG          PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG609   GCCCATGA         PPDB MotifGCCCA  PLACE Motif 
 OsREG587         GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG474          AGGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG630           GGCCCATA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.