version
PlantPromoterDB promoter information of J033095M02

Summary of Gene (J033095M02)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0613200        NCBI 
Gene model J033095M02  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 25032131-25030932)

Genome position     
from initiation codon
AK064869            
AK065051            
AK098853            
AK098974            
J013000H15          
J013000J01          
J013001I18          
J013022I18          
J013025D06          
J013037H17          
J013039E11          
J013043F22          
J013075E01          
J013088D09          
J013088E19          
J013093A08          
J013102O18          
J013110C08          
J013118C06          
J013119F22          
J013128K14          
J013158C17          
J023013P15          
J023044L21          
J033023I04          
J033027J24          
J033038I22          
J043022F05          
J080307N20          
J080315C02          
J080316A15          
J080316G03          
J090029E24          
J090031H15          
J090034F13          
J090047G02          
J090069M24          
J100052E15          
TSS from cDNA
TSS information
J033095M02                       5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033095M02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-25032055-924
TSS clone peakGclone-25031962-831

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTCC-2503198225031989-851-858
Y PatchTCTCTCTC-2503199525032002-864-871
Y PatchTCTCTCTCTCTCTCC-2503207325032087-942-956
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCGTG-2503202425032031-893-900
 OsREG502GTGGCGTG PPDB Motif  PLACE Motif 
REGCCCGGCCC-2503214525032152-1014-1021
 OsREG538CCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGGGACGCGTGG-2503216025032169-1029-1038
 OsREG442GGACGCGT   PPDB Motif  PLACE Motif 
 OsREG443  ACGCGTGG PPDB Motif  PLACE Motif 
REGGCCCCCACGTGGC-2503219825032210-1067-1079
 OsREG613GCCCCCAC      PPDB Motif  PLACE Motif 
 OsREG536 CCCCCACG     PPDB Motif  PLACE Motif 
 OsREG450  CCCCACGT    PPDB MotifACGT  PLACE Motif 
 OsREG508   CCCACGTG   PPDB MotifACGT  PLACE Motif 
 OsREG507     CACGTGGC PPDB MotifACGT  PLACE MotifACGTGKC 
REGACACGTGGGACCCAC-2503221925032233-1088-1102
 OsREG434ACACGTGG        PPDB MotifACGT  PLACE Motif 
 OsREG508 CACGTGGG       PPDB MotifACGT  PLACE Motif 
 OsREG650    GTGGGACC    PPDB MotifGGGACCC  PLACE Motif 
 OsREG648     TGGGACCC   PPDB MotifGGGACCC  PLACE Motif 
 OsREG637      GGGACCCA  PPDB MotifGGGACCC  PLACE Motif 
 OsREG622       GGACCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGCCCCCACTGAC-2503227025032281-1139-1150
 OsREG613GCCCCCAC     PPDB Motif  PLACE Motif 
 OsREG522    CCACTGAC PPDB Motif  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.