version
PlantPromoterDB promoter information of J033099K13

Summary of Gene (J033099K13)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0549300        NCBI 
Gene model J033099K13  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 27659154-27657955)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
J033099K13                       5'->3' (-)
Promoter sequence

 
                    
Os08g0549400        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033099K13

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-27656600-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTCCTCCTCCC-2765661127656627-57-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGCCACGTGGGCCCCACC-2765669527656712-141-158
 OsREG448CGCCACGT           PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG          PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG508   CACGTGGG        PPDB MotifACGT  PLACE Motif 
 OsREG449    ACGTGGGC       PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571     CGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640      GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647       TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641        GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631         GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612          GCCCCACC PPDB Motif  PLACE Motif 
REGTCGGCCCG-2765672827656735-174-181
 OsREG568TCGGCCCG PPDB MotifACGGGC  PLACE Motif 
REGAAACGGCCCATCC-2765674227656754-188-200
 OsREG420AAACGGCC      PPDB MotifAAACG(C/G)  PLACE Motif 
 OsREG423 AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445  ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG490   CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590    GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG608     GCCCATCC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGA-2765675927656766-205-212
 OsREG644GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTCAGCCCACCAAC-2765677227656784-218-230
 OsREG657TCAGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG462  AGCCCACC    PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG520     CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGCATGGGCCGGA-2765686127656871-307-317
 OsREG517CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG490 ATGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644   GGGCCGGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.