version
PlantPromoterDB promoter information of J033107K04

Summary of Gene (J033107K04)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0665700        NCBI 
Gene model J033107K04  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34380637-34381836)

Genome position     
from initiation codon
013-084-D06         
AK121951            
J013020L20          
J033034K12          
J065014E01          
J065037F07          
J065044C03          
J065103I10          
J065106P15          
J065142G06          
J075061O20          
J075091P11          
J075095A18          
J075117C22          
J075166B22          
J075198L04          
J080068D08          
J090032K13          
J090045E22          
TSS from cDNA
TSS information
J033107K04                       5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033107K04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+34381515-122

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCTCTCTCTC+3438148634381499-151-138
Y PatchCCCCTTCC+3438153534381542-102-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTGGCCCAAAGCCCAAG+3438136134381377-276-260
 OsREG653GTGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG659 TGGCCCAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA        PPDB MotifGCCCA  PLACE Motif 
 OsREG421       AAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG426        AAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG459         AGCCCAAG PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCAAAGCCCAACT+3438143934381456-198-181
 OsREG587GAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA          PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG421       AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426        AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458         AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479          GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.