version
PlantPromoterDB promoter information of J033108M05

Summary of Gene (J033108M05)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0522500        NCBI 
Gene model J033108M05  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 26066365-26065166)

Genome position     
from initiation codon
006-026-A04         
006-037-B02         
006-047-E11         
015-049-E10         
AK060080            
AK102814            
AK104718            
AK106190            
J013068H02          
J033116M13          
J065211H04          
J075195H03          
J075195I24          
TSS from cDNA
TSS information
J033108M05                       5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033108M05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-26065446-81

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCCTCCTCC-2606540326065412-38-47
Y PatchCTCTCTCT-2606541926065426-54-61
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGGCCCATCT-2606553326065544-168-179
 OsREG440ACCGGCCC     PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456    GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGAAATGGGCCTT-2606557826065588-213-223
 OsREG422AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431 AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT PPDB MotifGCCCA  PLACE Motif 
REGTGGGGGATG-2606564726065655-282-290
 OsREG482TGGGGGAT  PPDB Motif  PLACE Motif 
 OsREG516 GGGGGATG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.