version
PlantPromoterDB promoter information of J033109G09

Summary of Gene (J033109G09)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0220600        NCBI 
Gene model J033109G09  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 6749721-6750920)

Genome position     
from initiation codon
009-091-E01         
J033100M18          
TSS from cDNA
TSS information
J033109G09                       5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033109G09

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCAAGGCCCGTT+67507976750807AK061944, AK104946, D89802, J013042L22, J013056A14, J013120G13, J013155K19, J023002B10, J023080J19, J023081C08, J023090H05, J023091M07, J023115F09, J033025I23, J033026G12, J033035E15, J033040N13, J033046C17, J033069F02, J033071B16, J033071N22, J033088J02, J033092N24, J033093I09, J033126G06, J043003G15, J043010M11, J043024O20, J065092N03, J080004D17, J080010L09, J080021I11, J080022L01, J080029B01, J080032D11, J080039B11, J080040K17, J080041B21, J080052L24, J080054M12, J080057B15, J080078G15, J080078H06, J080079M03, J080088H16, J080093C11, J080095K09, J080095O20, J090009J19, J090040D04, J090052E14, J090063B14, J090071K04, J090075E12, J090087A06, J090094P03, J090098M14
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG424   GGCCCGTT PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGATCCAACGG+67508116750819AK061944, AK104946, D89802, J013042L22, J013056A14, J013120G13, J013155K19, J023002B10, J023080J19, J023081C08, J023090H05, J023091M07, J023115F09, J033025I23, J033026G12, J033035E15, J033040N13, J033046C17, J033069F02, J033071B16, J033071N22, J033088J02, J033092N24, J033093I09, J033126G06, J043003G15, J043010M11, J043024O20, J065092N03, J080004D17, J080010L09, J080021I11, J080022L01, J080029B01, J080032D11, J080039B11, J080040K17, J080041B21, J080052L24, J080054M12, J080057B15, J080078G15, J080078H06, J080079M03, J080088H16, J080093C11, J080095K09, J080095O20, J090009J19, J090040D04, J090052E14, J090063B14, J090071K04, J090075E12, J090087A06, J090094P03, J090098M14
 OsREG481ATCCAACG  PPDB MotifCCAACGG  PLACE Motif 
 OsREG548 TCCAACGG PPDB MotifCCAACGG  PLACE Motif 
REGGGGCCAGA+67508336750840AK061944, AK104946, D89802, J013042L22, J013056A14, J013120G13, J013155K19, J023002B10, J023080J19, J023081C08, J023090H05, J023091M07, J023115F09, J033025I23, J033026G12, J033035E15, J033040N13, J033046C17, J033069F02, J033071B16, J033071N22, J033088J02, J033092N24, J033093I09, J033126G06, J043003G15, J043010M11, J043024O20, J065092N03, J080004D17, J080010L09, J080021I11, J080022L01, J080029B01, J080032D11, J080039B11, J080040K17, J080041B21, J080052L24, J080054M12, J080057B15, J080078G15, J080078H06, J080079M03, J080088H16, J080093C11, J080095K09, J080095O20, J090009J19, J090040D04, J090052E14, J090063B14, J090071K04, J090075E12, J090087A06, J090094P03, J090098M14
 OsREG638GGGCCAGA PPDB MotifGCCCA  PLACE Motif 
REGGCCGTCCGATC+67508866750896AK061944, AK104946, D89802, J013042L22, J013056A14, J013120G13, J013155K19, J023002B10, J023080J19, J023081C08, J023090H05, J023091M07, J023115F09, J033025I23, J033026G12, J033035E15, J033040N13, J033046C17, J033069F02, J033071B16, J033071N22, J033088J02, J033092N24, J033093I09, J033126G06, J043003G15, J043010M11, J043024O20, J065092N03, J080004D17, J080010L09, J080021I11, J080022L01, J080029B01, J080032D11, J080039B11, J080040K17, J080041B21, J080052L24, J080054M12, J080057B15, J080078G15, J080078H06, J080079M03, J080088H16, J080093C11, J080095K09, J080095O20, J090009J19, J090040D04, J090052E14, J090063B14, J090071K04, J090075E12, J090087A06, J090094P03, J090098M14
 OsREG562GCCGTCCG    PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC PPDB Motif  PLACE Motif 
REGATCGGACGGCC+67509146750924AK061944, AK104946, D89802, J013042L22, J013056A14, J013120G13, J013155K19, J023002B10, J023080J19, J023081C08, J023090H05, J023091M07, J023115F09, J033025I23, J033026G12, J033035E15, J033040N13, J033046C17, J033069F02, J033071B16, J033071N22, J033088J02, J033092N24, J033093I09, J033126G06, J043003G15, J043010M11, J043024O20, J065092N03, J080004D17, J080010L09, J080021I11, J080022L01, J080029B01, J080032D11, J080039B11, J080040K17, J080041B21, J080052L24, J080054M12, J080057B15, J080078G15, J080078H06, J080079M03, J080088H16, J080093C11, J080095K09, J080095O20, J090009J19, J090040D04, J090052E14, J090063B14, J090071K04, J090075E12, J090087A06, J090094P03, J090098M14
 OsREG484ATCGGACG    PPDB Motif  PLACE Motif 
 OsREG545 TCGGACGG   PPDB Motif  PLACE Motif 
 OsREG562  CGGACGGC  PPDB Motif  PLACE Motif 
 OsREG624   GGACGGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.