version
PlantPromoterDB promoter information of J033114G05

Summary of Gene (J033114G05)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0191100        NCBI 
Gene model J033114G05  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 4851218-4852417)

Genome position     
from initiation codon
009-011-A02         
009-028-D05         
009-058-B11         
009-151-D09         
013-026-G03         
013-035-B05         
013-063-F04         
013-069-B05         
014-029-E04         
014-072-H04         
014-089-E09         
015-047-G05         
016-033-G06         
AK058815            
J023069C08          
J023077K21          
J023081F19          
J033052N11          
J033058N11          
J033114O17          
J033129L14          
J053029I12          
J065067N19          
J065084I19          
J065099O03          
J065201I08          
J075035B08          
J075037B22          
J075054L16          
J075059D15          
J075164I08          
J075185J01          
J090042O06          
J090044F12          
J090063L02          
J090073I10          
J090078E18          
J100072K16          
TSS from cDNA
TSS information
J033114G05                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033114G05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+4851435-783

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCTGTATAAATC+48513954851406-823-812
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCACCTGTGGGCCTTCTGGGCTTTT+48512034851227-1015-991
 OsREG436CCACCTGT                  PPDB Motif  PLACE Motif 
 OsREG627     TGTGGGCC             PPDB MotifGCCCA  PLACE Motif 
 OsREG472      GTGGGCCT            PPDB MotifGCCCA  PLACE Motif 
 OsREG430       TGGGCCTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG428               CTGGGCTT   PPDB MotifGCCCA  PLACE Motif 
 OsREG421                TGGGCTTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG419                 GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCACACG+48512394851250-979-968
 OsREG656TAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG627  GGCCCACA   PPDB MotifGCCCA  PLACE Motif 
 OsREG598   GCCCACAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG526    CCCACACG PPDB MotifGCCCA  PLACE Motif 
REGGCCCATGGGCCTGG+48512564851269-962-949
 OsREG525GCCCATGGGC     PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517   CATGGGCC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG474    ATGGGCCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG513     TGGGCCTG  PPDB MotifGCCCA  PLACE Motif 
 OsREG524      GGGCCTGG PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCACGA+48512734851284-945-934
 OsREG644TCCGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  CGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571   GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG601    GCCCACGA PPDB MotifGCCCA  PLACE Motif 
REGCAACGGCT+48513004851307-918-911
 OsREG469CAACGGCT PPDB MotifCCAACGG  PLACE Motif 
REGCGGACGGC+48513604851367-858-851
 OsREG562CGGACGGC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.