version
PlantPromoterDB promoter information of J033115L11

Summary of Gene (J033115L11)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0644000        NCBI 
Gene model J033115L11  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 26782858-26781659)

Genome position     
from initiation codon
AB081464            
AK101360            
AY062178            
J023043E22          
J033024F05          
J033035H01          
J033042J19          
J033057G18          
J033111F09          
J033143I16          
J033143M21          
J075072B10          
J075072L04          
J075088F01          
J075196H23          
TSS from cDNA
TSS information
J033115L11                       5'->3' (-)
Promoter sequence









 
011-012-C02         
AK102431            
J023001D23          
J023093F04          
J033039A10          
J033076H01          
J033093H17          
J090027G21          
J090053K18          
J090078F05          
J090082L11          
J100032M03          
J100045O22          
J100059C20          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033115L11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-26782067-209

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCCGGCCC-2678212426782131-266-273
 OsREG644TCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGTGTGGGCTGGGCTGG-2678214726782161-289-303
 OsREG461TGTGGGCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG523  TGGGCTGGGCTGG PPDB MotifGCCCA  PLACE Motif 
 OsREG533   GGGCTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG603    GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG464     GCTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG512      CTGGGCTG  PPDB MotifGCCCA  PLACE Motif 
REGCTCTCCGC-2678218526782192-327-334
 OsREG576CTCTCCGC PPDB Motif  PLACE Motif 
REGGTGGCGTGGGCCGTCGGATC-2678228326782302-425-444
 OsREG502GTGGCGTG             PPDB Motif  PLACE Motif 
 OsREG602   GCGTGGGC          PPDB MotifGCCCA  PLACE Motif 
 OsREG571    CGTGGGCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG564     GTGGGCCG        PPDB MotifGCCCA  PLACE Motif 
 OsREG445      TGGGCCGT       PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG584       GGGCCGTC      PPDB MotifGCCCA  PLACE Motif 
 OsREG546          CCGTCGGA   PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG483           CGTCGGAT  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG588            GTCGGATC PPDB MotifCCGAC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.