PlantPromoterDB promoter information of J033119A06
Summary of Gene (J033119A06)
|
Overview
|
Focused view (chromosome 4: 34175644-34176843)
|
Genome position
from initiation codon AB037150 AK061835 AK103551 AK104076 J013093O22 J013157M03 J023014C08 J023027D02 J023042D23 J023047F07 J033025N04 J033048F09 J033103A21 J033132F12 J033140J24 J053071I02 J053077D04 J065139H14 J065151N12 J065162O03 J065168J04 J090067G20 J090072N04 J090086L10 J090087A05 J090095N01 J100039F24 J100079J06 TSS from cDNA TSS information J033119A06 5'->3' (+) Promoter sequence J043026N08
J065015K02 J065095F01 J065171F06 J065197N19 J075014H22 J075022C22 J075025O06 J075059J15 J075106D08 J075115L09 J075118P19 J075132A09 J075143H07 J075153C02 J075161C08 J075178F02 J075187C13 TSS from cDNA TSS information 3'->5' (-) Promoter sequence |
|
|
|
Promoter Summary of J033119A06
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | None | None | None | ||||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| TSS clone | A | clone | + | 34175994 | J100039F24, J053077D04, 006-090-F11, J090095N01 |
| TSS clone peak | A | clone | + | 34176042 | J100039F24, J053077D04, 006-090-F11, J090095N01 |
| TSS clone | G | clone | + | 34176052 | J100039F24, J053077D04, 006-090-F11, J090095N01 |
| TSS clone | A | clone | + | 34176066 | J100039F24, J053077D04, 006-090-F11, J090095N01 |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | GTTGGTGGTCATGGGCCAAAAAGCCCAACT | + | 34175843 | 34175872 | 006-090-F11, J053077D04, J090095N01, J100039F24 | ||||
| OsREG520 | GTTGGTGG | PPDB Motif | CCAACGG | PLACE Motif | |||||
| OsREG609 | TCATGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG517 | CATGGGCC | PPDB Motif | GCCCA, CCATGG | PLACE Motif | |||||
| OsREG488 | ATGGGCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG660 | TGGGCCAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG419 | AAAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG421 | AAAGCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG426 | AAGCCCAA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG458 | AGCCCAAC | PPDB Motif | GCCCA, CCAACGG | PLACE Motif | |||||
| OsREG479 | GCCCAACT | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | TCTGGACC | + | 34175890 | 34175897 | 006-090-F11, J053077D04, J090095N01, J100039F24 | ||||
| OsREG649 | TCTGGACC | PPDB Motif | PLACE Motif | ||||||