version
PlantPromoterDB promoter information of J033119A20

Summary of Gene (J033119A20)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0571400        NCBI 
Gene model J033119A20  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 23640935-23642134)

Genome position     
from initiation codon
AK103109            
J023011A12          
J053034N16          
J053045N23          
J053052J12          
J053052K04          
J053099M15          
J065071H23          
J065131B16          
J075003F19          
J075116F02          
J075126G05          
J075145E09          
J075149O22          
J075163A09          
J075194A09          
L29471              
TSS from cDNA
TSS information
J033119A20                       5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033119A20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+23641547-388

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTTCCTCTTCCTCCTC+2364153423641552-401-383
Y PatchTCTCCTCCT+2364158323641591-352-344
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCAAAC+2364125223641259-683-676
 OsREG593GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCACGCCAC+2364132323641330-612-605
 OsREG502CACGCCAC PPDB Motif  PLACE Motif 
REGAAATGGGCTGGGCTTG+2364141323641428-522-507
 OsREG422AAATGGGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG432 AATGGGCT        PPDB MotifGCCCA  PLACE Motif 
 OsREG491  ATGGGCTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG523   TGGGCTGG      PPDB MotifGCCCA  PLACE Motif 
 OsREG533    GGGCTGGG     PPDB MotifGCCCA  PLACE Motif 
 OsREG603     GGCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG464      GCTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG428       CTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG496        TGGGCTTG PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAACA+2364143723641447-498-488
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458  AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594   GCCCAACA PPDB MotifGCCCA  PLACE Motif 
REGGTCCCTCA+2364145023641457-485-478
 OsREG652GTCCCTCA PPDB MotifGGGACCC  PLACE Motif 
REGAGCCCATTAAGCCCATT+2364146723641483-468-452
 OsREG432AGCCCATT AGCCCATT PPDB MotifGCCCA  PLACE Motif 
 OsREG610 GCCCATTA         PPDB MotifGCCCA  PLACE Motif 
 OsREG655       TAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG429        AAGCCCAT  PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.