version
PlantPromoterDB promoter information of J033119F15

Summary of Gene (J033119F15)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0831100        NCBI 
Gene model J033119F15  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 35763694-35762495)

Genome position     
from initiation codon
AK103115            
J065011M19          
J075019I08          
J075026I18          
J075047A01          
J075096P21          
J075111A02          
J075121I05          
J075121I07          
J090063F13          
J090068F16          
J090094E14          
TSS from cDNA
TSS information
J033119F15                       5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033119F15

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-35762760-66

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGGGTATAAACC-3576278935762799-95-105
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGCCCAGCCCATGGGC-3576281635762833-122-139
 OsREG656TAGGCCCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG473 AGGCCCAG          PPDB MotifGCCCA  PLACE Motif 
 OsREG620  GGCCCAGC         PPDB MotifGCCCA  PLACE Motif 
 OsREG603   GCCCAGCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG533    CCCAGCCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG523     CCAGCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG491      CAGCCCAT     PPDB MotifGCCCA  PLACE Motif 
 OsREG467       AGCCCATG    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525        GCCCATGGGC PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTGATGGGCCTA-3576285235762862-158-168
 OsREG607TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGCTCGGCCCAGT-3576288935762899-195-205
 OsREG575CTCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565  CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG454   GGCCCAGT PPDB MotifGCCCA  PLACE Motif 
REGAACGGCCCGGCC-3576291435762925-220-231
 OsREG423AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG446 ACGGCCCG    PPDB MotifACGGGC  PLACE Motif 
 OsREG544  CGGCCCGG   PPDB Motif  PLACE Motif 
 OsREG616   GGCCCGGC  PPDB Motif  PLACE Motif 
 OsREG614    GCCCGGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.