version
PlantPromoterDB promoter information of J033120G20

Summary of Gene (J033120G20)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0685600        NCBI 
Gene model J033120G20  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 28112132-28110933)

Genome position     
from initiation codon
AK111863            
J033024B20          
J053032B21          
J053050E18          
J053062E18          
J053080L14          
J065016K08          
J090001K10          
J090006D01          
J090080J03          
TSS from cDNA
TSS information
J033120G20                       5'->3' (-)
Promoter sequence





 
AK066043            
J013048F08          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of J033120G20

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone-28111645AK111863, AK111863
TSS clone peakGclone+28112058AK066043, AK066043, J013048F08

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCGGCCCCGACCCGC-2811169128111706AK111863
 OsREG538CCCGGCCC         PPDB MotifGCCCA  PLACE Motif 
 OsREG552        CGACCCGC PPDB Motif  PLACE Motif 
REGGGGCCGTT-2811171628111723AK111863
 OsREG423GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
REGCCTGGGCCGGG-2811172828111738AK111863
 OsREG550CCTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG538   GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGCGACCCGC-2811174728111754AK111863
 OsREG552CGACCCGC PPDB Motif  PLACE Motif 
REGGGGCCGGGGCCGGG-2811176428111777AK111863
 OsREG538GGGCCGGGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCCGGCCC+2811176428111777AK066043, J013048F08
 OsREG538CCCGGCCCCGGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGATGGGCCTTGGGCTTT+2811194728111964AK066043, J013048F08
 OsREG553CGATGGGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT         PPDB MotifGCCCA  PLACE Motif 
 OsREG430   TGGGCCTT        PPDB MotifGCCCA  PLACE Motif 
 OsREG497    GGGCCTTG       PPDB MotifGCCCA  PLACE Motif 
 OsREG459        CTTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG426         TTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421          TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGCCGTGGGCTGT+2811196828111978AK066043, J013048F08
 OsREG547CCGTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG463 CGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG435   TGGGCTGT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCAAT+2811199628112005AK066043, J013048F08
 OsREG656TAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492  GGCCCAAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.